![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence zma-MIR2275a |
||||||
Accession | MI0011278 (change log) | |||||
Description | Zea mays miR2275a stem-loop | |||||
Gene family | MIPF0000797; MIR2275 | |||||
Literature search |
![]()
10 open access papers mention zma-MIR2275a | |||||
Stem-loop |
----- a - -- gga ag 5' gucaggc acugaa gugaga guuggaggaaagcaaaccggcugg guauc uuc c ||||||| |||||| |||||| |||||||||||||||||||||||| ||||| ||| 3' uagucug ugacuu cacucu uaaccuccuuuuguuuggcuggcc cgugg agg a auagc c a gu --g ca |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
The mature product from the 5' arm of the hairpin dominates over the 3' arm, but the conservation signature with rice suggests that the 3' arm may be functional [1]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence zma-miR2275a-5p |
|
Accession | MIMAT0011767 |
Sequence |
18 - agaguuggaggaaagcaaacc - 38 |
Deep sequencing | 24 reads, 7 experiments |
Evidence | experimental; 454 [1] |
Database links |
|
Mature sequence zma-miR2275a-3p |
|
Accession | MIMAT0011768 |
Sequence |
81 - uuuguuuuccuccaauaucuca - 102 |
Deep sequencing | 4 reads, 3 experiments |
Evidence | experimental; 454 [1] |
References |
|
1 |
PMID:19584097
"Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
Genome Res. 19:1429-1440(2009).
|