Stem-loop sequence osa-MIR2118a

Accession

MI0011251 (change log)

Description

Oryza sativa miR2118a stem-loop

Gene family

MIPF0000745; MIR2118

Literature search

29 open access papers mention osa-MIR2118a
(168 sentences)

Stem-loop

   g           aaaga    c        ua      c     -a   a           --    ucu   caucua      cc ucc     g 
5'  ggaagaggaag     gagg uccaagag  guagga uggga  cau ugagaaagcau  gagc   auc      uccauc  c   cauuc c
    |||||||||||     |||| ||||||||  |||||| |||||  ||| |||||||||||  ||||   |||      ||||||  |   |||||  
3'  ccuucuccuuc     cuuc agguucuu  uauccu acccu  gua gcucuuuugua  cucg   uag      aggugg  g   guaag u
   -           -----    a        gc      u     cc   -           uu    cuu   ------      ac -uu     a 

Deep sequencing

1 reads, 0 reads per million, 1 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr4: 21642923-21643101 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR2118a

• osa-MIR2118h: Chr4: 21652652-21652808 [-]
• osa-MIR2118i: Chr4: 21652388-21652568 [-]
• osa-MIR2118f: Chr4: 21650514-21650682 [-]
• osa-MIR5522: Chr4: 21650324-21650436 [+]
• osa-MIR2118g: Chr4: 21650301-21650460 [-]
• osa-MIR2118c: Chr4: 21647968-21648064 [-]
• osa-MIR2118d: Chr4: 21647689-21647864 [-]
• osa-MIR2118e: Chr4: 21647428-21647604 [-]
• osa-MIR2118b: Chr4: 21645285-21645463 [-]
• osa-MIR1869: Chr4: 21644852-21644989 [+]
• osa-MIR2118a: Chr4: 21642923-21643101 [-]

Database links

• miRBase Tracker:MI0011251

Mature sequence osa-miR2118a

• Accession: MIMAT0011740
• Sequence: 131 - uucucgaugccucccauuccua - 152
• Evidence: experimental; 454 [1]

References

1. PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).