Stem-loop sequence sbi-MIR1432

AccessionMI0010930 (change log)
DescriptionSorghum bicolor miR1432 stem-loop
Gene family MIPF0001063; MIR1432
Literature search

1 open access papers mention sbi-MIR1432
(12 sentences)

Stem-loop
   gauaggacauaggaggcgagagggacgacgagccguugguuugu    --   c          -    a           g  g          -----   u  a 
5'                                             gggu  gug guccuaugcu cagg gagaugacacc ac ucggacggac     cgg cg u
                                               ||||  ||| |||||||||| |||| ||||||||||| || ||||||||||     ||| || c
3'                                             cccg  cau caggauacga gucc cucuacugugg ug agccugccug     gcc gc c
   ------------------------acuuuugucccucuacauga    ac   u          a    g           g  a          ucugu   -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 71616755-71616938 [-]
intergenic
Database links

Mature sequence sbi-miR1432

Accession MIMAT0011390
Sequence

61 - 

cucaggagagaugacaccgac

 - 81

Get sequence
Evidence by similarity; MI0009715

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).