Stem-loop sequence sbi-MIR437w

AccessionMI0010923 (change log)
DescriptionSorghum bicolor miR437w stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437w
(5 sentences)

Stem-loop
   ----    uc        a            a        ugcauc   -   uccaac   aaauu   a   -u     u u cg    a 
5'     uaaa  ucucuaau uuuaccaaguuu uagaaaaa      aac auu      auc     agu uca  uaaau c c  ugaa u
       ||||  |||||||| |||||||||||| ||||||||      ||| |||      |||     ||| |||  ||||| | |  |||| a
3'     guuu  agagauug aagugguucaaa aucuuuuu      uug uaa      uag     uca agu  auuua g g  acuu u
   uuca    ga        a            a        ---uuu   a   ---uuu   -augu   -   uc     c u au    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 55103062-55103234 [+]
intergenic
Database links

Mature sequence sbi-miR437w

Accession MIMAT0011383
Sequence

153 - 

aaaguuagagaaguuugacuu

 - 173

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).