Stem-loop sequence sbi-MIR437v

AccessionMI0010922 (change log)
DescriptionSorghum bicolor miR437v stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437v
(5 sentences)

Stem-loop
   --         a  uuca       auaucauggagcauuugaugaaacugcuuugaua 
5'   gucaaacuu cu    cugacuu                                  u
     ||||||||| ||    |||||||                                  u
3'   caguuugaa ga    gauugaa                                  g
   uu         -  ----       acagguucaaauaucuuuuuacguaguuguagau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 53285464-53285577 [+]
intergenic
Database links

Mature sequence sbi-miR437v

Accession MIMAT0011382
Sequence

94 - 

aaaguuagagaaguuugacuu

 - 114

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).