Stem-loop sequence sbi-MIR437u

AccessionMI0010921 (change log)
DescriptionSorghum bicolor miR437u stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437u
(5 sentences)

Stem-loop
   ---      --        g g  ug u   uu          ua    c     caagcugaaauaagugcacuaucaagaca 
5'    uuaaac  cucuaacu u ac  a uuu  uggaaaaaua  uuaa aucug                             u
      ||||||  |||||||| | ||  | |||  ||||||||||  |||| |||||                              
3'    aguuug  gagauuga a ug  u aaa  aucuuuuuau  gguu uagau                             g
   uuc      aa        a g  gu c   -u          gc    a     acuguaguuuaaucaaaguaauuuaagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 52942441-52942604 [+]
intergenic
Database links

Mature sequence sbi-miR437u

Accession MIMAT0011381
Sequence

144 - 

aaaguuagagaaguuugacuu

 - 164

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).