Stem-loop sequence sbi-MIR437t

AccessionMI0010920 (change log)
DescriptionSorghum bicolor miR437t stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437t
(5 sentences)

Stem-loop
   --         g    u             ----       a   u       a a         ----------ga uc     uc       
5'   gucaaacuu ucua cuuugaccaaguu    gaaaaau uau aacaucu c auaucaaau            a  cacua  gaaaua 
     ||||||||| |||| |||||||||||||    ||||||| ||| ||||||| | |||||||||            |  |||||  ||||| u
3'   caguuugaa agau gaaacugguucaa    cuuuuua gug uuguaga g uguaguuug            u  guggu  cuuuau 
   uu         g    u             auau       c   u       c a         auauaaguaacg gu     -c       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 5483558-5483727 [+]
intergenic
Database links

Mature sequence sbi-miR437t

Accession MIMAT0011380
Sequence

150 - 

aaaguuagagaaguuugacuu

 - 170

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).