Stem-loop sequence sbi-MIR437s

AccessionMI0010919 (change log)
DescriptionSorghum bicolor miR437s stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437s
(5 sentences)

Stem-loop
   --                      u  ag    a       acacucaaacaucuagaauaucagaugaguuucauuagauucuuuau 
5'   aagucaaacuucuuuaacuuug cc  guuu uagaaaa                                               g
     |||||||||||||||||||||| ||  |||| |||||||                                                
3'   uucaguuugaagagauugaaac gg  cgaa aucuuuu                                               c
   ga                      u  ca    a       auaugacuguaaauguucaaguuuauuuaagagauaguuuuauauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 48978172-48978347 [-]
intergenic
Database links

Mature sequence sbi-miR437s

Accession MIMAT0011379
Sequence

154 - 

aaaguuagagaaguuugacuu

 - 174

Get sequence
Evidence by similarity; MI0007021

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).