Stem-loop sequence sbi-MIR437r

AccessionMI0010918 (change log)
DescriptionSorghum bicolor miR437r stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437r
(5 sentences)

Stem-loop
   ---   a          u      a      c        a  ------     a     uac  c       u     u    aa    c   g 
5'    agu aaacuucucu auuuug ccaagu uauagaaa au      guacu auauu   aa aucaaau aguuu auuc  uuca cau c
      ||| |||||||||| |||||| |||||| |||||||| ||      ||||| |||||   || ||||||| ||||| ||||  |||| ||| a
3'    uca uuugaagaga ugaaac gguuca auaucuuu ua      cgugg uauga   uu ugguuua ucaag ugag  aggu gug a
   gau   g          u      c      a        a  uguaac     a     -ca  a       u     -    --    u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 35916153-35916332 [-]
intergenic
Database links

Mature sequence sbi-miR437r

Accession MIMAT0011378
Sequence

158 - 

aaaguuagagaaguuugacuu

 - 178

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).