Stem-loop sequence sbi-MIR437q

AccessionMI0010917 (change log)
DescriptionSorghum bicolor miR437q stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437q
(5 sentences)

Stem-loop
   -gu      c      g      -ga   g  a       aauauaauuaacaucuacgaugccaaaugaaugcaucauc 
5'    agucaa cuucuc aacuuu   caa uu auagaaa                                        a
      |||||| |||||| ||||||   ||| || |||||||                                         
3'    ucaguu gaagag uugaaa   guu ag uaucuuu                                        a
   gau      u      a      aug   g  a       cuccgucgcuacugauguucugaugcuguuguuuaaauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 10928435-10928594 [-]
intergenic
Database links

Mature sequence sbi-miR437q

Accession MIMAT0011377
Sequence

138 - 

aaaguuagagaaguuugacuu

 - 158

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).