Stem-loop sequence sbi-MIR437p

AccessionMI0010916 (change log)
DescriptionSorghum bicolor miR437p stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437p
(5 sentences)

Stem-loop
   --au                ac             a   c    auau        c     uac     ----------    g      c   --a  c 
5'     gucaaacuucucuaac  ugaccgaguuugu gga aaau    acuagcau uacaa   caaau          aaau cacuau aag   gu a
       ||||||||||||||||  ||||||||||||| ||| ||||    |||||||| |||||   |||||          |||| |||||| |||   ||  
3'     caguuugaagagauug  acugguucaaaua cuu uuua    ugguugug auguu   guuua          uuua guggua uuu   ca a
   gauu                aa             a   u    --cc        u     uua     aucaaaguag    g      c   aaa  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 8535896-8536083 [-]
intergenic
Database links

Mature sequence sbi-miR437p

Accession MIMAT0011376
Sequence

166 - 

aaaguuagagaaguuugacuu

 - 186

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).