Stem-loop sequence sbi-MIR437o

AccessionMI0010915 (change log)
DescriptionSorghum bicolor miR437o stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437o
(5 sentences)

Stem-loop
   --     --      a        - a         gaaaaaugcaccauccucuacaacaucaaauuaguuucauuaaauucucuaug 
5'   aaguc  acuuuu uaacuuug c agguuuuua                                                     a
     |||||  |||||| |||||||| | |||||||||                                                      
3'   uucag  ugaaga auugaaac g uucaaaaau                                                     a
   ga     uu      g        u a         auuuuuuauauaauugucgauguccaaguguauuuacgugaugguucuguaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 66944221-66944395 [-]
intergenic
Database links

Mature sequence sbi-miR437o

Accession MIMAT0011375
Sequence

153 - 

aaaguuagagaaguuugacuu

 - 173

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).