Stem-loop sequence sbi-MIR437m

AccessionMI0010913 (change log)
DescriptionSorghum bicolor miR437m stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437m
(5 sentences)

Stem-loop
   ----        ca         --aaa      ac       augcacc     ---    aa  uc    ua   -   uuaa     c 
5'     gucaaacu  ucuaacuuu     caaguu  uagaaaa       aacau   cuag  ua  aaau  gcu uca    auuuu c
       ||||||||  |||||||||     ||||||  |||||||       |||||   ||||  ||  ||||  ||| |||    |||||  
3'     caguuuga  agauugaaa     guucaa  aucuuuu       uugua   gauc  au  uuug  uga ggu    uaaag a
   gauu        ag         aacug      aa       aauauaa     uau    aa  ua    ug   u   ucug     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr3: 49072062-49072235 [-]
intergenic
Database links

Mature sequence sbi-miR437m

Accession MIMAT0011373
Sequence

152 - 

aaaguuagagaaguuugacuu

 - 172

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).