Stem-loop sequence sbi-MIR437l

AccessionMI0010912 (change log)
DescriptionSorghum bicolor miR437l stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437l
(5 sentences)

Stem-loop
   --          g     a   a    a   a          cacc    --g  --aa  cc     a    a      -   ucca 
5'   gucaaacuuu uuaac uug ccaa uuu uagaaaaaug    aaca   ac    ca  aaauu guuu auuaaa uuu    u
     |||||||||| ||||| ||| |||| ||| ||||||||||    ||||   ||    ||  ||||| |||| |||||| |||     
3'   caguuugaag gauug aac gguu aaa aucuuuuuau    uugu   ug    gu  uuuaa cgag uaguuu gaa    a
   uu          a     a   c    c   a          auaa    aga  aaga  uu     -    a      c   uaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 45977539-45977708 [+]
intergenic
Database links

Mature sequence sbi-miR437l

Accession MIMAT0011372
Sequence

150 - 

aaaguuagagaaguuugacuu

 - 170

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).