Stem-loop sequence sbi-MIR437k

AccessionMI0010911 (change log)
DescriptionSorghum bicolor miR437k stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437k
(5 sentences)

Stem-loop
   --au                         ac  a          cac    aauaacaucagcuaguuugauuaauucuccauaaa 
5'     gucaaacuucucuaacuuugaccaa  uu uagaaaaaua   caac                                   a
       |||||||||||||||||||||||||  || ||||||||||   ||||                                    
3'     caguuugaagagauugaaacugguu  aa aucuuuuuau   guug                                   u
   gauu                         ca  a          aca    aagauguuuaaguuuauuuacgugauuauucugua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 9804351-9804522 [-]
intergenic
Database links

Mature sequence sbi-miR437k

Accession MIMAT0011371
Sequence

150 - 

aaaguuagagaaguuugacuu

 - 170

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).