Stem-loop sequence sbi-MIR437j

AccessionMI0010910 (change log)
DescriptionSorghum bicolor miR437j stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437j
(5 sentences)

Stem-loop
   --                        a    -a           ccaauaguuucaacgucaaauauguuucauuagauucuccaa 
5'   gucaaacuucucuaacuuugacca guuu  uagaaaaugca                                          g
     |||||||||||||||||||||||| ||||  |||||||||||                                          a
3'   caguuugaagagauugaaacuggu caaa  guuuuuuaugu                                          a
   uu                        a    aa           aauuguagauguucauguuuauuuacacgauaguucuguaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 80858050-80858221 [+]
intergenic
Database links

Mature sequence sbi-miR437j

Accession MIMAT0011370
Sequence

152 - 

aaaguuagagaaguuugacuu

 - 172

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).