Stem-loop sequence sbi-MIR437i

AccessionMI0010909 (change log)
DescriptionSorghum bicolor miR437i stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437i
(5 sentences)

Stem-loop
   --                      c      c      guuauauuaacaucuucaguaccaaauaaauguacuaucaagacauu 
5'   gucaaacuucuuuaacuuugac aaguuu uagaaa                                               u
     |||||||||||||||||||||| |||||| ||||||                                                
3'   caguuugaagagauugaaacug uucaaa aucuuu                                               g
   uu                      u      u      uuacgugguaauagaugugguaguuaaucaaaacaaucuagguggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 67375016-67375185 [+]
intergenic
Database links

Mature sequence sbi-miR437i

Accession MIMAT0011369
Sequence

150 - 

aaaguuagagaaguuugacuu

 - 170

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).