Stem-loop sequence sbi-MIR437f

AccessionMI0010907 (change log)
DescriptionSorghum bicolor miR437f stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437f
(5 sentences)

Stem-loop
   ---                      aaa    c         a a      c   u      ccaaauaaaugcacu   aa     a 
5'    agucaaacuucucuaacuuuga   aagu uguagaaaa u uauuaa auc acaaua               auc  gacau u
      ||||||||||||||||||||||   |||| ||||||||| | |||||| ||| ||||||               |||  ||||| u
3'    ucaguuugaagagauugaaacu   uuca auaucuuuu a gugguu uag uguugu               uag  uugua u
   gau                      -gg    a         c c      c   u      uuaaucaaaguaauu   -g     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 64048458-64048631 [-]
intergenic
Database links

Mature sequence sbi-miR437f

Accession MIMAT0011367
Sequence

152 - 

aaaguuagagaaguuugacuu

 - 172

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).