Stem-loop sequence sbi-MIR437d

AccessionMI0010905 (change log)
DescriptionSorghum bicolor miR437d stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437d
(5 sentences)

Stem-loop
   --       u           --cgaa         uauuaacaucuauaucuauacaagauaaaugaa 
5'   aagucaa cuucucuaacu      gaguuuaua                                 c
     ||||||| |||||||||||      |||||||||                                  
3'   uucaguu gaagagauuga      uucaaauau                                 c
   gg       u           aauugg         ccuuuuacgugguuauaaauguuguaguguaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 23949013-23949148 [-]
intergenic
Database links

Mature sequence sbi-miR437d

Accession MIMAT0011365
Sequence

114 - 

aaaguuagagaaguuugacuu

 - 134

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).