Stem-loop sequence sbi-MIR437c

AccessionMI0010904 (change log)
DescriptionSorghum bicolor miR437c stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437c
(5 sentences)

Stem-loop
   --             ua         aau      cuaacaauuuauauagguugacaacaaacgauugacaucaauagauuuauuau 
5'   gucaaacuucuuu  aauuuugau   caauau                                                     g
     |||||||||||||  |||||||||   ||||||                                                     a
3'   caguuugaagaga  uugaaacua   guuaua                                                     a
   uu             --         agu      aauacuuuuauauaguagaauuacuuuucuuagcauauaauauuuuuuuacca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 20698964-20699138 [+]
intergenic
Database links

Mature sequence sbi-miR437c

Accession MIMAT0011364
Sequence

155 - 

aaaguuagagaaguuugacuu

 - 175

Get sequence
Evidence not experimental

References

1
" Zhang L, Ware D Unpublished (2009).