Stem-loop sequence sbi-MIR437b

AccessionMI0010903 (change log)
DescriptionSorghum bicolor miR437b stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437b
(5 sentences)

Stem-loop
   ---                        ug     c      a         auacaauacuaaauaaaagcauuaucaagacauau 
5'    ucaaacuucucuaauuuugaucaa  uuaua aaaaau uauuagcau                                   u
      ||||||||||||||||||||||||  ||||| |||||| |||||||||                                    
3'    aguuugaagagauugaaacugguu  aauau uuuuua gugguugua                                   u
   uuc                        ca     c      c         gacuuuguaguuuaauaaaguaauguagaugguac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 19748293-19748463 [+]
intergenic
Database links

Mature sequence sbi-miR437b

Accession MIMAT0011363
Sequence

151 - 

aaaguuagagaaguuugacuu

 - 171

Get sequence
Evidence by similarity; MI0007021

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).