Stem-loop sequence sbi-MIR437a

AccessionMI0010902 (change log)
DescriptionSorghum bicolor miR437a stem-loop
Gene family MIPF0000746; MIR437
Literature search

3 open access papers mention sbi-MIR437a
(5 sentences)

Stem-loop
   --                ugu   a                uauauaa      cua        ccaaguuuacagaaauauauauaaugacaucu 
5'   aagucaaacuucucua   uuu acuaaguuuauagaaa       caacau   gaauacca                                a
     ||||||||||||||||   ||| ||||||||||||||||       ||||||   ||||||||                                g
3'   uucaguuugaagagau   aaa ugauuuagauauuuuu       guugua   uuuguggu                                a
   ga                -ug   c                --ccacg      --a        uuaauuauagaacucucacgugaacgaacaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 3118652-3118841 [-]
intergenic
Database links

Mature sequence sbi-miR437a

Accession MIMAT0011362
Sequence

168 - 

aaaguuagagaaguuugacuu

 - 188

Get sequence
Evidence not experimental

References

1
" Zhang L, Ware D Unpublished (2009).