Stem-loop sequence sbi-MIR397

AccessionMI0010899 (change log)
DescriptionSorghum bicolor miR397 stem-loop
Gene family MIPF0000120; MIR397
Literature search

3 open access papers mention sbi-MIR397
(10 sentences)

Stem-loop
   uc                a      a c        ca    u   u 
5'   auugagugcagcguug ugagcc g uggccggc  gccg gcg c
     |||||||||||||||| |||||| | ||||||||  |||| ||| c
3'   uaacucacgucgcggc acucgg c accggccg  cggc cgc g
   -u                c      - -        --    -   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 4003721-4003811 [-]
intergenic
Database links

Mature sequence sbi-miR397-5p

Accession MIMAT0011359
Previous IDssbi-miR397
Sequence

1 - 

ucauugagugcagcguugaug

 - 21

Get sequence
Evidence not experimental

Mature sequence sbi-miR397-3p

Accession MIMAT0020940
Sequence

71 - 

ucaccggcgcugcacucaauu

 - 91

Get sequence
Evidence experimental; 454 [2]

References

1
" Zhang L, Ware D Unpublished (2009).
2
PMID:21907786 "Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum" Zhang L, Zheng Y, Jagadeeswaran G, Li Y, Gowdu K, Sunkar R Genomics. 98:460-468(2011).