Stem-loop sequence sbi-MIR396e

AccessionMI0010898 (change log)
DescriptionSorghum bicolor miR396e stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention sbi-MIR396e
(9 sentences)

Stem-loop
   -      ca                g   ucguggggguagaaaccuugcuggguuugguucccaugucggauggaaugcuuggcuccucccag 
5'  uuucca  ggcuuucuugaacugu aac                                                                 c
    ||||||  |||||||||||||||| |||                                                                  
3'  aaaggu  ccgaaagaacuuggua uug                                                                 g
   c      ac                g   uccaucucggccggcucgcuucgcucuuuggggcguuaaguuaagugagugccggccccuucuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 59881923-59882111 [+]
intergenic
Database links

Mature sequence sbi-miR396e

Accession MIMAT0011358
Sequence

2 - 

uuccacaggcuuucuugaacug

 - 23

Get sequence
Evidence by similarity; MI0001703

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).