Stem-loop sequence sbi-MIR394b

AccessionMI0010889 (change log)
DescriptionSorghum bicolor miR394b stem-loop
Gene family MIPF0000100; MIR394
Literature search

1 open access papers mention sbi-MIR394b
(2 sentences)

Stem-loop
   ---c      u c           uugccgaucgau   g 
5'     uuggca u uguccaccucc            cuu c
       |||||| | |||||||||||            ||| a
3'     aaccgu a acggguggagg            gaa g
   aggu      c u           ---uuuuuuuuu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sbi-miR394b

Accession MIMAT0011349
Sequence

2 - 

uuggcauucuguccaccucc

 - 21

Get sequence
Evidence by similarity; MI0001794

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).