Stem-loop sequence sbi-MIR171k

AccessionMI0010884 (change log)
DescriptionSorghum bicolor miR171k stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention sbi-MIR171k
(2 sentences)

Stem-loop
   --  g                       a  cuu c     aaa 
5'   cg gauauuggcgcgguucaaucaga ag   g gcucc   g
     || ||||||||||||||||||||||| ||   | |||||    
3'   gc cuauaaccgugccgaguuaguuu uc   c cgggg   c
   cu  a                       c  -ac u     acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 56762480-56762566 [-]
intergenic
Database links

Mature sequence sbi-miR171k

Accession MIMAT0011344
Sequence

62 - 

ugauugagccgugccaauauc

 - 82

Get sequence
Evidence by similarity; MI0001835

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).