Stem-loop sequence sbi-MIR171j

AccessionMI0010883 (change log)
DescriptionSorghum bicolor miR171j stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention sbi-MIR171j
(2 sentences)

Stem-loop
   gc   c          a           aucaucagaugauguauuuuaaauu 
5'   gag gauauuggug gguucaaucag                         u
     ||| |||||||||| |||||||||||                         a
3'   uuc cuauaaccgc ccgaguuaguc                         c
   -c   a          g           agggaccccuaaguggaaguacgua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 5806673-5806780 [-]
intergenic
Database links

Mature sequence sbi-miR171j

Accession MIMAT0011343
Sequence

83 - 

ugauugagccgcgccaauauc

 - 103

Get sequence
Evidence by similarity; MI0001491

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).