Stem-loop sequence sbi-MIR171i

AccessionMI0010882 (change log)
DescriptionSorghum bicolor miR171i stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention sbi-MIR171i
(2 sentences)

Stem-loop
   ---        u       c        u aa     ag g  gaa 
5'    guguuggc cggcuca ucagaagc g  auagu  u au   u
      |||||||| ||||||| |||||||| |  |||||  | ||    
3'    uauaaccg gccgagu agucuuug c  uaucg  g ua   c
   uuc        u       u        - gg     au g  aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 59668493-59668582 [-]
intergenic
Database links

Mature sequence sbi-miR171i

Accession MIMAT0011342
Sequence

68 - 

ugauugagccgugccaauauc

 - 88

Get sequence
Evidence by similarity; MI0001792

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).