Stem-loop sequence sbi-MIR171h

AccessionMI0010881 (change log)
DescriptionSorghum bicolor miR171h stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention sbi-MIR171h
(2 sentences)

Stem-loop
   --            c          ag         auuu 
5'   gguauuggcgcg cucaauccga  gcguggcug    g
     |||||||||||| ||||||||||  |||||||||    g
3'   cuauaacugcgc gaguuagguu  uguaccgac    c
   cu            c          cu         ggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 15602519-15602599 [-]
intergenic
Database links

Mature sequence sbi-miR171h

Accession MIMAT0011341
Sequence

59 - 

ggauugagccgcgucaauauc

 - 79

Get sequence
Evidence by similarity; MI0006537

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).