Stem-loop sequence sbi-MIR171g

AccessionMI0010880 (change log)
DescriptionSorghum bicolor miR171g stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention sbi-MIR171g
(2 sentences)

Stem-loop
   --        a         c    aua         aa 
5'   uauuggug gguucaauc gaug   gguuuuaca  c
     |||||||| ||||||||| ||||   |||||||||   
3'   auaaccgc ccgaguuag cuau   cuaaaaugu  a
   cu        g         u    -ga         cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 54394753-54394829 [+]
intergenic
Database links

Mature sequence sbi-miR171g

Accession MIMAT0011340
Sequence

57 - 

ugauugagccgcgccaauauc

 - 77

Get sequence
Evidence by similarity; MI0000680

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).