Stem-loop sequence sbi-MIR167i

AccessionMI0010872 (change log)
DescriptionSorghum bicolor miR167i stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

3 open access papers mention sbi-MIR167i
(6 sentences)

Stem-loop
   --     a    c  -            uu     g   -cc  -u   a     -c      g   cc 
5'   aguga gcug ca gcaugaucuagc  ugguu gca   au  ggc ggcgc  cacaca ugg  u
     ||||| |||| || ||||||||||||  ||||| |||   ||  ||| |||||  |||||| |||   
3'   uuacu cgac gu cguacuagauug  acuaa cgu   ug  ucg ccgug  gugugu gcc  c
   cu     c    a  a            uu     a   cca  uc   -     au      -   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr8: 59223214-59223345 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR167i
sbi-MIR167ichr8: 59223214-59223345 [+]
sbi-MIR167echr8: 59225502-59225680 [+]
Database links

Mature sequence sbi-miR167i

Accession MIMAT0011332
Sequence

3 - 

ugaagcugccagcaugaucua

 - 23

Get sequence
Evidence by similarity; MI0001475

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).