Stem-loop sequence sbi-MIR167h

AccessionMI0010871 (change log)
DescriptionSorghum bicolor miR167h stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

3 open access papers mention sbi-MIR167h
(8 sentences)

Stem-loop
   --            c         aag   acgag  c       u 
5'   ugaagcugccag augaucuga   cau     uc uucguua c
     |||||||||||| |||||||||   |||     || ||||||| a
3'   acuuugacgguc uacuagacu   gua     ag aaguagu u
   uu            -         --a   gauaa  a       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 76577898-76577987 [-]
intergenic
Database links

Mature sequence sbi-miR167h

Accession MIMAT0011331
Sequence

1 - 

ugaagcugccagcaugaucug

 - 21

Get sequence
Evidence by similarity; MI0001551

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).