Stem-loop sequence sbi-MIR156i

AccessionMI0010863 (change log)
DescriptionSorghum bicolor miR156i stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention sbi-MIR156i
(22 sentences)

Stem-loop
   a        -     -        a      g   a       g   ugaaccgagacg  g 
5'  cugacaga agaga gugagcac cagcgg cag cugcauc auc            ac c
    |||||||| ||||| |||||||| |||||| ||| ||||||| |||            ||  
3'  gacugucu ucucu cacucgug gucguc guc gacguag uag            ug a
   a        c     u        c      -   -       -   uaguaguaagga  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 57028197-57028317 [+]
intergenic
Database links

Mature sequence sbi-miR156i

Accession MIMAT0011323
Sequence

3 - 

ugacagaagagagugagcac

 - 22

Get sequence
Evidence by similarity; MI0001462

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).