Stem-loop sequence sbi-MIR156h

AccessionMI0010862 (change log)
DescriptionSorghum bicolor miR156h stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention sbi-MIR156h
(22 sentences)

Stem-loop
   ---         -   -         a     gggc          cg     
5'    gugacagaa gag agugagcac cggcc    gugacggcac  guca 
      ||||||||| ||| ||||||||| |||||    ||||||||||  ||| a
3'    uacugucuu cuc ucacucgug gccgg    cgcugccgug  uagg 
   gcc         u   g         c     ----          --     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 49965689-49965782 [-]
intergenic
Database links

Mature sequence sbi-miR156h

Accession MIMAT0011322
Sequence

2 - 

ugacagaagagagugagcac

 - 21

Get sequence
Evidence by similarity; MI0000657

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).