Stem-loop sequence sbi-MIR156g

AccessionMI0010861 (change log)
DescriptionSorghum bicolor miR156g stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention sbi-MIR156g
(28 sentences)

Stem-loop
   --        -    -         a      g  ga       cgg 
5'   gugacaga agag agugagcac cggccg cg  acggcac   c
     |||||||| |||| ||||||||| |||||| ||  |||||||    
3'   uacugucu ucuc ucacucgug gccggc gc  ugccgug   g
   cc        a    g         c      -  --       uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 56252122-56252210 [-]
intergenic
Database links

Mature sequence sbi-miR156g

Accession MIMAT0011321
Sequence

2 - 

ugacagaagagagugagcac

 - 21

Get sequence
Evidence by similarity; MI0000661

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).