Stem-loop sequence sbi-MIR156f

AccessionMI0010860 (change log)
DescriptionSorghum bicolor miR156f stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention sbi-MIR156f
(22 sentences)

Stem-loop
   --          -    -           u    c  a    aucuauauacggcugcuccuggcg 
5'   gcugacagaa gaga gugagcacgca cggc ag cugc                        a
     |||||||||| |||| ||||||||||| |||| || ||||                         
3'   cgacugucuu cucu cacucgugcgu gucg uc gacg                        g
   cu          u    u           u    -  -    cggaucuguagguagguagguaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 59370555-59370682 [+]
intergenic
Database links

Mature sequence sbi-miR156f

Accession MIMAT0011320
Sequence

3 - 

ugacagaagagagugagcac

 - 22

Get sequence
Evidence by similarity; MI0001458

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).