Stem-loop sequence pvu-MIR319c

AccessionMI0010705 (change log)
DescriptionPhaseolus vulgaris miR319c stem-loop
Gene family MIPF0000010; MIR159
Literature search

2 open access papers mention pvu-MIR319c
(16 sentences)

Stem-loop
   ---g    u            c    c   --    u   uacaa    uu    ug aaaauuaaccacuaacucauucacacaauaguauucaguuagggugaug 
5'     agag gaaggagcuucc ucag cca  uuca gga     aaga  gggu  c                                                 c
       |||| |||||||||||| |||| |||  |||| |||     ||||  ||||  |                                                  
3'     ucuu cuuccucgaggg aguc ggu  gagu ucu     uucu  ccca  g                                                 u
   guug    u            a    a   uc    c   -----    --    gu uguuauacauacguagugaaguaaguguguuaguauaauaucguuuuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PhaVulg1_0; GCA_000499845.1) Overlapping transcripts
chr8: 49086396-49086599 [+]
intergenic
Database links

Mature sequence pvu-miR319c

Accession MIMAT0011176
Sequence

174 - 

uuggacugaagggagcuccuu

 - 194

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).