Stem-loop sequence pvu-MIR2119

AccessionMI0010703 (change log)
DescriptionPhaseolus vulgaris miR2119 stem-loop
Gene family MIPF0000762; MIR2119
Literature search

2 open access papers mention pvu-MIR2119
(4 sentences)

Stem-loop
   aucaauguuguuacuuuuacacuuuauuuucuaugcuu                   uauu         ugaa     uu      c   gauu 
5'                                       uuccucuacaacucucuuu    uuggagaaa    gugga  ucuacu uuu    g
                                         |||||||||||||||||||    |||||||||    |||||  |||||| |||     
3'                                       aaggggauguugagggaaa    aacuuuuuu    uaucu  agguga aaa    g
   --------------------------------------                   --cu         ----     uu      a   aaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PhaVulg1_0; GCA_000499845.1) Overlapping transcripts
chr2: 8674179-8674326 [+]
intergenic
Database links

Mature sequence pvu-miR2119

Accession MIMAT0011174
Sequence

128 - 

ucaaagggaguuguaggggaa

 - 148

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).