Stem-loop sequence pvu-MIR482

AccessionMI0010702 (change log)
DescriptionPhaseolus vulgaris miR482 stem-loop
Gene family MIPF0000403; MIR482
Literature search

3 open access papers mention pvu-MIR482
(15 sentences)

Stem-loop
    ug           -u          -c    aaa  u   g 
5' u  ugggaaugggc  gauugggaag  aaug   ac caa c
   |  |||||||||||  ||||||||||  ||||   || |||  
3' a  auccuuacccg  uuaacccuuc  uuac   ug guu a
    gu           cc          uu    auc  u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PhaVulg1_0; GCA_000499845.1) Overlapping transcripts
chr8: 862464-862547 [+]
intergenic
Database links

Mature sequence pvu-miR482-5p

Accession MIMAT0011172
Previous IDspvu-miR482*
Sequence

6 - 

ggaaugggcugauugggaagca

 - 27

Get sequence
Evidence experimental; cloned [1], Northern [1]

Mature sequence pvu-miR482-3p

Accession MIMAT0011173
Previous IDspvu-miR482
Sequence

58 - 

ucuucccaauuccgcccauucc

 - 79

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).