Stem-loop sequence pvu-MIR1514a

AccessionMI0010701 (change log)
DescriptionPhaseolus vulgaris miR1514a stem-loop
Literature search

4 open access papers mention pvu-MIR1514a
(95 sentences)

Stem-loop
   -------auugaagaacac    c  a     u  cu   uuc   ug  ug       ggcuu    -               a        -------------     ac 
5'                    cuug cu ccuuc ca  gca   uuu  aa  gaaacag     uccu guuuucauuuugaaa uaggcauu             gcauu  a
                      |||| || ||||| ||  |||   |||  ||  |||||||     |||| ||||||||||||||| ||||||||             |||||  u
3'                    gaau ga ggaag gu  ugu   aaa  uu  uuuuguc     agga caaaaguagaauuuu auccguaa             cguag  u
   uuaacuucuugagcccuca    a  a     u  --   --c   gu  gu       -acau    a               -        ccuuaaccuucug     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PhaVulg1_0; GCA_000499845.1) Overlapping transcripts
chr3: 23530620-23530821 [+]
intergenic
Database links

Mature sequence pvu-miR1514a

Accession MIMAT0011171
Sequence

65 - 

uucauuuugaaaauaggcauug

 - 86

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).