Stem-loop sequence pvu-MIR159a

AccessionMI0010700 (change log)
DescriptionPhaseolus vulgaris miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

4 open access papers mention pvu-MIR159a
(15 sentences)

Stem-loop
               ga       uu      cu    ----   ug   u     g     c      uc      uu     -  ucag 
5' guggagcuccuu  aguccaa  gaggau  uacu    ggg  gau gagcu cuuag uaugga  ccacag  cuacc ca    c
   ||||||||||||  |||||||  ||||||  ||||    |||  ||| ||||| ||||| ||||||  ||||||  ||||| ||    a
3' caucucgaggga  uuagguu  uuccua  auga    ucc  cua uucga ggguc auaccu  gguguu  gaugg gu    u
               ag       uc      cu    uauc   gu   c     g     u      uc      cu     u  uuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PhaVulg1_0; GCA_000499845.1) Overlapping transcripts
chr4: 43298214-43298387 [+]
intergenic
Database links

Mature sequence pvu-miR159a.2

Accession MIMAT0011170
Previous IDspvu-miR159a
Sequence

107 - 

cuuccauaucuggggagcuuc

 - 127

Get sequence
Evidence experimental; cloned [1]

Mature sequence pvu-miR159a.1

Accession MIMAT0015301
Sequence

153 - 

uuuggauugaagggagcucua

 - 173

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).