Stem-loop sequence pvu-MIR2118

AccessionMI0010699 (change log)
DescriptionPhaseolus vulgaris miR2118 stem-loop
Gene family MIPF0000745; MIR2118
Literature search

3 open access papers mention pvu-MIR2118
(11 sentences)

Stem-loop
   --------------aa    uu        g       a        -           -uaa     ug 
5'                 gagc  aaggaagu augggag uggguggg uugguaaaaca    gagaa  a
                   ||||  |||||||| ||||||| |||||||| |||||||||||    |||||  a
3'                 uucg  uuccuuua uauccuu acccaccu agccguuuugu    cucuu  u
   ucucaccuuucucucc    -u        g       -        u           cuca     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PhaVulg1_0; GCA_000499845.1) Overlapping transcripts
chr7: 2635274-2635398 [+]
intergenic
Database links

Mature sequence pvu-miR2118

Accession MIMAT0011169
Sequence

73 - 

uugccgauuccacccauuccua

 - 94

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:19353277 "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress" Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL Plant Mol Biol. 70:385-401(2009).