Stem-loop sequence ssc-mir-146b

AccessionMI0010685 (change log)
DescriptionSus scrofa miR-146b stem-loop
Gene family MIPF0000103; mir-146
Literature search

21 open access papers mention ssc-mir-146b
(104 sentences)

Stem-loop 
   ga   u    -  -  u   u  g        a    a    cu  ga  u 
5'   acu uggc ca cc ggc cu agaacuga uucc uagg  gu  gc c
     ||| |||| || || ||| || |||||||| |||| ||||  ||  ||  
3'   uga aucg gu gg ccg gg ucuugacu aagg aucc  ua  cg u
   -c   u    u  c  c   u  -        c    -    cg  aa  a
Get sequence
Deep sequencing
1188 reads, 53.3 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr14: 123301752-123301850 [+]
intergenic
Database links

Mature sequence ssc-miR-146b

Accession MIMAT0010190
Sequence

21 -  

ugagaacugaauuccauaggc

 - 41

Get sequence
Deep sequencing1187 reads, 15 experiments
Evidence experimental; 454 [1], Illumina [2-4]

References

1
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).