Stem-loop sequence ssc-mir-1

Accession

MI0010682 (change log)

Previous IDs

ssc-mir-1a

Description

Sus scrofa miR-1 stem-loop

Gene family

MIPF0000038; mir-1

Literature search

47 open access papers mention ssc-mir-1
(281 sentences)

Stem-loop

        -u  c  a   -     gg g                gc     ---   a 
5' ccggu  ga gu ccu gcuug  g acauacuucuuuaugu  ccaua   ugg c
   |||||  || || ||| |||||  | ||||||||||||||||  |||||   ||| c
3' ggcca  cu ca ggg cggac  u uguaugaagaaaugua  gguau   auc u
        cu  -  a   u     uu a                -a     cga   g 

Deep sequencing

4568 reads, 1.84e+03 reads per million, 15 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr17: 69285393-69285500 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR1A
• miRBase Tracker:MI0010682

Mature sequence ssc-miR-1

• Accession: MIMAT0010187
• Previous IDs: ssc-miR-1a
• Sequence: 64 - uggaauguaaagaaguaugua - 84
• Deep sequencing: 4566 reads, 15 experiments
• Evidence: experimental; 454 [1], Illumina [2,4-5], cloned [3]

References

1. PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3. PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).