Stem-loop sequence ssc-mir-101-2

Accession

MI0010679 (change log)

Previous IDs

ssc-mir-101a-2

Description

Sus scrofa miR-101-2 stem-loop

Gene family

MIPF0000046; mir-101

Literature search

12 open access papers mention ssc-mir-101-2
(26 sentences)

Stem-loop

          cuggc                  a    gucca 
5' ggcugcc     ucaguuaucacagugcug ugcu     u
   |||||||     |||||||||||||||||| ||||      
3' ccgacgg     agucaauagugucaugac augg     u
          uagga                  -    aaauc 

Deep sequencing

76053 reads, 1.55e+04 reads per million, 15 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr6: 135736115-135736195 [+]
• Overlapping transcripts:

  sense

  ENSSSCT00000021585 ; ssc-mir-101-2.1-201; exon 1

Database links

• EntrezGene:MIR101A-2
• miRBase Tracker:MI0010679

Mature sequence ssc-miR-101

• Accession: MIMAT0010185
• Previous IDs: ssc-miR-101a
• Sequence: 50 - uacaguacugugauaacugaa - 70
• Deep sequencing: 152273 reads, 15 experiments
• Evidence: experimental; 454 [1], Illumina [2,4-5], cloned [3]

References

1. PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
2. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3. PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
4. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).