Stem-loop sequence lmi-mir-8

AccessionMI0010646 (change log)
DescriptionLocusta migratoria miR-8 stem-loop
Gene family MIPF0000019; mir-8
Literature search

3 open access papers mention lmi-mir-8
(9 sentences)

Stem-loop
   --    -     g     c      uug ga 
5'   cauc uuacc ggcag auuaga   c  c
     |||| ||||| ||||| ||||||   |   
3'   guag aaugg cuguc uaaucu   g  u
   cu    c     a     a      uua ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lmi-miR-8-5p

Accession MIMAT0010148
Previous IDslmi-miR-8*
Sequence

1 - 

caucuuaccgggcagcauuaga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence lmi-miR-8-3p

Accession MIMAT0010149
Previous IDslmi-miR-8
Sequence

39 - 

uaauacugucagguaacgauguc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1