Stem-loop sequence ath-MIR2112

AccessionMI0010632 (change log)
DescriptionArabidopsis thaliana miR2112 stem-loop
Gene family MIPF0001195; MIR2112
Literature search

2 open access papers mention ath-MIR2112
(7 sentences)

Stem-loop
   guau  a                     c  u   a    g   aa   accaaua  ggu    agcgaaa   ac 
5'     ga augaugcgcaaaugcggauau aa gua auca gac  caa       ga   gcuc       aca  a
       || ||||||||||||||||||||| || ||| |||| |||  |||       ||   ||||       |||   
3'     cu uacuacgcguuuacgccuaua uu cau uagu cug  guu       cu   uggg       ugu  a
   cagu  c                     u  c   a    a   gg   acaaaga  auu    --aaaag   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 234006-234159 [-]
intergenic
Database links

Mature sequence ath-miR2112-5p

Accession MIMAT0011154
Sequence

14 - 

cgcaaaugcggauaucaaugu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ath-miR2112-3p

Accession MIMAT0011155
Sequence

123 - 

cuuuauauccgcauuugcgca

 - 143

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19307293 "Computational and analytical framework for small RNA profiling by high-throughput sequencing" Fahlgren N, Sullivan CM, Kasschau KD, Chapman EJ, Cumbie JS, Montgomery TA, Gilbert SD, Dasenko M, Backman TW, Givan SA, Carrington JC RNA. 15:992-1002(2009).