Stem-loop sequence ame-mir-981

AccessionMI0010618 (change log)
DescriptionApis mellifera miR-981 stem loop
Gene family MIPF0000710; mir-981
Stem-loop
   gggaa   a    -aa   c          -     g       -u  u 
5'      ugg ugca   cgu uggguuucgu gacag cgagccg  uc u
        ||| ||||   ||| |||||||||| ||||| |||||||  || u
3'      acc acgu   gca guccaaagca cuguu gcuuggu  ag a
   ---aa   a    cua   c          a     -       uc  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
CM000055.5: 11334461-11334554 [-]
intergenic
Database links

Mature sequence ame-miR-981-3p

Accession MIMAT0010121
Sequence

58 - 

uucguugucaacgaaaccugca

 - 79

Get sequence
Evidence experimental; Illumina [2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).