Stem-loop sequence ame-mir-985

AccessionMI0010614 (change log)
DescriptionApis mellifera miR-985 stem loop
Stem-loop
   gaaaggguagaaacgaucgaucgaucgacaaa  g auu    ---     u 
5'                                 ug c   uauu   acguu c
                                   || |   ||||   |||||  
3'                                 ac g   auaa   uguaa a
   ------------------ugacuuuauuaugg  g gcu    ccu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
CM000056.5: 15328712-15328796 [-]
intergenic
Database links

Mature sequence ame-miR-985-3p

Accession MIMAT0010118
Sequence

51 - 

aaaauguuccaauaucgggca

 - 71

Get sequence
Evidence experimental; Illumina [2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).