Stem-loop sequence ame-mir-263b

AccessionMI0010611 (change log)
DescriptionApis mellifera miR-263b stem loop
Gene family MIPF0000122; mir-263
Literature search

3 open access papers mention ame-mir-263b
(13 sentences)

Stem-loop
   aa   -  ug      cu     c  g    a     a   -      
5'   ggu uc  gcgggu  uggca ug aaga uucac gau gugca 
     ||| ||  ||||||  ||||| || |||| ||||| ||| |||| g
3'   cca ag  cguuca  accgu ac uucu aggug cua uaugu 
   ag   u  gu      cu     a  g    -     -   a      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
CM000060.5: 7491899-7491989 [-]
intergenic
Database links

Mature sequence ame-miR-263b-5p

Accession MIMAT0010116
Sequence

16 - 

cuuggcacuggaagaauucac

 - 36

Get sequence
Evidence experimental; Illumina [2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).